View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_67 (Length: 248)
Name: NF17288_low_67
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 13050726 - 13050521
Alignment:
| Q |
20 |
ggaatagcttgaagcacaactttaataagaataccactccccgcagaagaaattttttctttccatcccttatgttttttcaccacataattgaaaagtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13050726 |
ggaatagcttgaagcacaactttaataagaataccactccccgcaaaagaaattttttctttccatcccttaagttttttcaccacataattgaaaagtt |
13050627 |
T |
 |
| Q |
120 |
gacaagtttttgactcatttgaaacatttttactaaaaacctatttagacttgtccatgtaaataatgatcgaccagaggtactttgacaatctttaaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13050626 |
gacaagtttttgactcatttgaaacatttttactaaaaacctatttagacttgtccatgtaaataatgatcgaccagaggtactttgacaatctttaaga |
13050527 |
T |
 |
| Q |
220 |
acatta |
225 |
Q |
| |
|
|||||| |
|
|
| T |
13050526 |
acatta |
13050521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University