View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_68 (Length: 245)
Name: NF17288_low_68
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 24904023 - 24904232
Alignment:
| Q |
18 |
aggcaaccgtaataataataacaacaatagnnnnnnnnnnnnnccgaggaatacaaacaacgagtttcagataagcagatcagaagaatctcaaggctca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24904023 |
aggcaaccgtaataataataacaacaatagaaaaaacaaaaaaccgaggaatacaaacaacgagtttcagataagcagatcagaagaatctcaaggctca |
24904122 |
T |
|
| Q |
118 |
gaaacaattattggtacgtatgccttctttagaaattttaaccaagataggtttttctcaagttttaatttcctctacaaaatgttttgaaaatgttgag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24904123 |
gaaacaattattggtacgtatgccttctttagaaattttaaccaagataggtttttctcaatttttaatttcctctacaaaatgttttgaaaatgttgag |
24904222 |
T |
|
| Q |
218 |
gaacatcctt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
24904223 |
gaacatcctt |
24904232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University