View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_69 (Length: 244)
Name: NF17288_low_69
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_69 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 144 - 244
Target Start/End: Original strand, 54961387 - 54961487
Alignment:
| Q |
144 |
gccgcctattttgaaaagaaaaatatatatacagtatgtggtaaagacactttgacctcatcatcagttttagaaagatgatgggttcggcagaggttga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54961387 |
gccgcctattttgaaaagaaaaatatatatacagtatgtggtaaagacactttgacctcatcatcagttttagaaagatgatgggttcggcagaggttga |
54961486 |
T |
|
| Q |
244 |
t |
244 |
Q |
| |
|
| |
|
|
| T |
54961487 |
t |
54961487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 16 - 136
Target Start/End: Original strand, 54961218 - 54961348
Alignment:
| Q |
16 |
atgcttagacacttcataatcacatctctctcttattttcttaaattattagtg-----------atgcttcatagtgtataaaaaatgcattggatctt |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54961218 |
atgcttagatacttcataatcacatctctctcttattttcttaaattattagtgatgtcgacgtcatgcttcatagtgtataaaaaatgcattgtatctt |
54961317 |
T |
|
| Q |
105 |
gtagacgaaataagctaggtagtcaataaacc |
136 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |
|
|
| T |
54961318 |
gtagacgaaataagcta-gtaatcaataaacc |
54961348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University