View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_70 (Length: 238)
Name: NF17288_low_70
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 99 - 223
Target Start/End: Complemental strand, 39785419 - 39785295
Alignment:
| Q |
99 |
tattgagttatgtaactagtaaatttacctgaagtcataacatatgcaatacacaacaatgcaatgaaaatgcactcggttaatgccaatagccatattc |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39785419 |
tattgagttatgtaactagtaaatctacctgaagtcataacatatgcaatacacaacaatgcaatgaaaatgcactctgttaatgccaatagccatattc |
39785320 |
T |
 |
| Q |
199 |
tcttctctactcagggtggaaaatc |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39785319 |
tcttctctactcagggtggaaaatc |
39785295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 39785518 - 39785449
Alignment:
| Q |
1 |
actcaagatagagtattcatttcaaactcctctttagatatgcaattaggttataaatgttaatgttatt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39785518 |
actcaagatagagtattcatttcaaactcctctttagatatgcaattaggttataaatgttaatgttatt |
39785449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University