View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_74 (Length: 229)
Name: NF17288_low_74
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 47 - 178
Target Start/End: Complemental strand, 8892755 - 8892624
Alignment:
| Q |
47 |
ttagcatgttagaaaagtttgtaatgatggatattttctaaaagattaattaacaaaattaagatatatttcattgaagggtgaaatggatacaaatgaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8892755 |
ttagcatgttagaaaagtttgtaatgatggatattttctaaaagattaattaactaaattaagatatatttcattgaagggtgaaatggatacaaatgaa |
8892656 |
T |
 |
| Q |
147 |
aatattacaattgcattagttaatattttgaa |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
8892655 |
aatattacaattgcattagataatattttgaa |
8892624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 47 - 123
Target Start/End: Complemental strand, 8892940 - 8892864
Alignment:
| Q |
47 |
ttagcatgttagaaaagtttgtaatgatggatattttctaaaagattaattaacaaaattaagatatatttcattga |
123 |
Q |
| |
|
||||||||||||||| ||| |||| ||| |||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
8892940 |
ttagcatgttagaaatttttttaattatgaatattttctaaaagattaattaactaaagtaaaatatatttcattga |
8892864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 8891739 - 8891703
Alignment:
| Q |
174 |
ttgaagtggtgcaacgtaaccaacaaaacagtactcc |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8891739 |
ttgaagtggtgcaacgtaaccagcaaaacagtactcc |
8891703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University