View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_77 (Length: 210)
Name: NF17288_low_77
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 32184660 - 32184460
Alignment:
| Q |
1 |
gatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcagcttctatgttctccttctttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32184660 |
gatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcagcttccatgttctccttctttt |
32184561 |
T |
|
| Q |
101 |
ctcacttccctactcttgctcaatcaatatctgatgcttctgctgagatttctgagataccagttccaggtattgcattttcacctttaccatattcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184560 |
ctcacttccctactcttgctcaatcaatatctgatgcttctgctgagatttctgagataccagttccaggtattgcattttcacctttaccatattcatc |
32184461 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
32184460 |
t |
32184460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 30 - 125
Target Start/End: Complemental strand, 32177464 - 32177369
Alignment:
| Q |
30 |
aatcactcaacaactttctctacctaactataccttgtttacttcttcagcttctatgttctccttcttttctcacttccctactcttgctcaatc |
125 |
Q |
| |
|
|||||||||| |||||||||| ||||| || | |||| |||||||| || ||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
32177464 |
aatcactcaaaaactttctctccctaattacatcttgaacacttcttcttctgctatgttctccttattctctcatttccctactcttgctcaatc |
32177369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 32177323 - 32177284
Alignment:
| Q |
162 |
agttccaggtattgcattttcacctttaccatattcatct |
201 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
32177323 |
agttccaggcattccattttcacctttaccatattcatct |
32177284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University