View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_78 (Length: 209)
Name: NF17288_low_78
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 50369192 - 50369013
Alignment:
| Q |
16 |
aaagggcatgaaggtaaattcgtaattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369192 |
aaagggcatgaaggtaaattcgtaattggtggtgattttccaacttttgctagctttggtaaggcttatgtatacggaacacccgttttggagtatccgg |
50369093 |
T |
 |
| Q |
116 |
gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369092 |
gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaat |
50369013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 192
Target Start/End: Complemental strand, 50379332 - 50379179
Alignment:
| Q |
39 |
aattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgggtttgattaaagccgcggtccat |
138 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||| ||||| | || ||| | || ||| |||| ||| ||||||||||| | || || || |
|
|
| T |
50379332 |
aattggtggtgattttccaacgtttgctagcttgggtagggttttattgtatggatcgccaagttttgagtttccaggtttgattaaggtggcagttcac |
50379233 |
T |
 |
| Q |
139 |
ggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatg |
192 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
50379232 |
ggtggtaacctgtgtgacccggataagagaccgtggggggcaggtgtgatgatg |
50379179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University