View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_81 (Length: 206)
Name: NF17288_low_81
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_81 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 36323689 - 36323795
Alignment:
| Q |
1 |
tgtcagcttaacttttaatgtatggatacaagacaacaaaggatgggatttgggtttgggaatctccaccattgctattgtctttgctatgatcaccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36323689 |
tgtcagcttaacttttaatgtatggatacaagacaacaaaggatgggatttgggtttgggaatctccaccattgctattgtctttgctatgatcaccttt |
36323788 |
T |
|
| Q |
101 |
gcctttg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
36323789 |
gcctttg |
36323795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 36330535 - 36330637
Alignment:
| Q |
1 |
tgtcagcttaacttttaatgtatggatacaagacaacaaaggatgggatttgggtttgggaatctccaccattgctattgtctttgctatgatcaccttt |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||| |||||||||||||| ||| || ||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36330535 |
tgtcagcttaacatttaatgtatggatacaaaacagcaaaggatgggattggggatttggaatatccaccattgctattgtctttgctatgatcatcttt |
36330634 |
T |
|
| Q |
101 |
gcc |
103 |
Q |
| |
|
||| |
|
|
| T |
36330635 |
gcc |
36330637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 50
Target Start/End: Original strand, 5458956 - 5459004
Alignment:
| Q |
2 |
gtcagcttaacttttaatgtatggatacaagacaacaaaggatgggatt |
50 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
5458956 |
gtcagcttaactttcattgtatggatacaaatcaacaaaggatgggatt |
5459004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University