View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_86 (Length: 204)
Name: NF17288_low_86
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 10481205 - 10481374
Alignment:
| Q |
21 |
ataatataccacatggtatgacttgctatatacaccccctacaaaataagtggctcttaaattagcaatcccctttcttactttattgttctcatttgat |
120 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||||||| | ||||||| ||| | |||||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
10481205 |
ataatataccacaaggtgtaacttgctatatacacccctttaaaaataaatggggcgtaaattagtaatcccctttcttaatttattaatctcatttgat |
10481304 |
T |
 |
| Q |
121 |
gaacttggtgattcaggacatatacaatttgggtggtagatcattttggatacacaacacaggacccatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10481305 |
gaacttggtgattcaggacatatacaatttgggtggtagatcattttggatacacaacacaggacccatt |
10481374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 10545648 - 10545599
Alignment:
| Q |
141 |
tatacaatttgggtggtagatcattttggatacacaacacaggacccatt |
190 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
10545648 |
tatacaatttgggggctagatcattttggatacacaacacaggacccatt |
10545599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University