View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17289_high_17 (Length: 226)
Name: NF17289_high_17
Description: NF17289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17289_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 2297505 - 2297698
Alignment:
| Q |
16 |
gaacatgagtgtaggttgtaactgggtaacacactatcctgcagaaagaaaaaagacttgtgcgatccccgggaatattggggttgcaatgatctcgata |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297505 |
gaacatgagtgtaggttgtaattgggtaacacactatcctgcagaaagaaaaaagacttgtgcgatccccgggaatattggggttgcaatgatctcgata |
2297604 |
T |
|
| Q |
116 |
gtataatgatgtccatagtataacattagtgtagttgcatcattcattttatgcatgtttcatttttatatatatttttggttgaggccatgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297605 |
gtataatgatgtccatagtataacattagtgtagttgcatcattcattttatgcatgtttcatttttatatatatttttggttgaggccatgtt |
2297698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University