View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17289_low_10 (Length: 253)

Name: NF17289_low_10
Description: NF17289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17289_low_10
NF17289_low_10
[»] chr3 (1 HSPs)
chr3 (1-240)||(38052873-38053112)


Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 38053112 - 38052873
Alignment:
1 aatgatcgtctgcgaaaaaatgcatgtttgagaatcaattaaattgattggatgagggtgattatttagaaatgaaatggaacatacggttttgccggca 100  Q
    ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38053112 aatgatcgtctgcgaaaaaatgcatgtgtgagaatcgattaaattgattggatgagggtgattatttagaaatgaaatggaacatacggttttgccggca 38053013  T
101 ccgttgggaccgacgattagggttaagggtttgaagaaggtgatgacgttcttgttttccgggtcgaaacttcggatgcctttgatcagcatcttgtcga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38053012 ccgttgggaccgacgattagggttaagggtttgaagaaggtgatgacgttcttgttttccgggtcgaaacttcggatgcctttgatcagcatcttgtcga 38052913  T
201 ccgtactcatttttgcttccctccttttcttcgcttcttc 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
38052912 ccgtactcatttttgcttccctccttttcttcgcttcttc 38052873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University