View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17289_low_14 (Length: 237)
Name: NF17289_low_14
Description: NF17289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17289_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 52351210 - 52350995
Alignment:
| Q |
1 |
ttaagcaatatggatgaggtgcggtatgtggacgttgatgaatctcacgatggtgtgggggtgagggttttcccatctctggaaaaagtgtctcgttact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
52351210 |
ttaagcaatatggatgaggtgcggtatgtggacgttgatgaatctcacgatggtgtgggggtgagggttttcccatctctggaaaaa--gtctcattact |
52351113 |
T |
 |
| Q |
101 |
aggtttgccaaactttgaacggttattgaaaatggaaaggggggagatgttccctcgtctttctgatttgaccatttgtggttgccctaaacttgtgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52351112 |
aggtttgccaaactttgaacggttattgaaaatggaaaggcgggagatgttc---cgtctttctgatttgaccatttgtggttgccctaaacttgtgttg |
52351016 |
T |
 |
| Q |
201 |
caattccttccatcccttaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52351015 |
caattccttccatcccttaaa |
52350995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 221
Target Start/End: Complemental strand, 30474484 - 30474410
Alignment:
| Q |
147 |
atgttccctcgtctttctgatttgaccatttgtggttgccctaaacttgtgttgcaattccttccatcccttaaa |
221 |
Q |
| |
|
||||||| || ||||||| ||||||||||| || |||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
30474484 |
atgttccttcttctttctaatttgaccattattgattgccctaaacttgtgttgccatgccttccatcccttaaa |
30474410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 171
Target Start/End: Complemental strand, 30399283 - 30399150
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctggaaaaagtgtctcgttactaggtttgccaaactttgaacggttattgaaaatgg |
135 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||| || || |||||| | | |||||| | || ||||||||||| ||| |
|
|
| T |
30399283 |
tgatgaatctcaggatggtgtggaggtgagggttttcccatctctggaggaa--ctccatttactatgcctaccaaacatagaggggttattgaaagtgg |
30399186 |
T |
 |
| Q |
136 |
aaaggggggagatgttccctcgtctttctgatttga |
171 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||| |||| |
|
|
| T |
30399185 |
aaagaggggagatgtttccttgtctttctgagttga |
30399150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 83
Target Start/End: Complemental strand, 29852517 - 29852470
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctgga |
83 |
Q |
| |
|
|||||||||| | |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29852517 |
tgatgaatctgaggatggtatggaggtgagggttttcccatctctgga |
29852470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 83
Target Start/End: Complemental strand, 29871404 - 29871357
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctgga |
83 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
29871404 |
tgatgaatctcaggatggtatggaggtgaggattttcccatctctgga |
29871357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 83
Target Start/End: Complemental strand, 30059575 - 30059528
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctgga |
83 |
Q |
| |
|
|||||||||| | |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30059575 |
tgatgaatctgaggatggtatggaggtgagggttttcccatctctgga |
30059528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 83
Target Start/End: Original strand, 30339410 - 30339457
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctgga |
83 |
Q |
| |
|
|||||||||| | |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30339410 |
tgatgaatctgaggatggtatggaggtgagggttttcccatctctgga |
30339457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 81
Target Start/End: Complemental strand, 30482622 - 30482577
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctg |
81 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||| ||||||| |
|
|
| T |
30482622 |
tgatgaatctcaggatggtgtggaggtgatggttttccgatctctg |
30482577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 30205658 - 30205602
Alignment:
| Q |
108 |
ccaaactttgaacggttattgaaaatggaaaggggggagatgttccctcgtctttct |
164 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||| || |||||||| ||| |||||||| |
|
|
| T |
30205658 |
ccaaacttagaagggttattgaaagtggaaagaggtgagatgtttccttgtctttct |
30205602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 30243257 - 30243301
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctct |
80 |
Q |
| |
|
|||||||||| | |||||| ||| ||||||||||||||||||||| |
|
|
| T |
30243257 |
tgatgaatctgaggatggtatggaggtgagggttttcccatctct |
30243301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 81
Target Start/End: Complemental strand, 26706550 - 26706505
Alignment:
| Q |
36 |
tgatgaatctcacgatggtgtgggggtgagggttttcccatctctg |
81 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
26706550 |
tgatgaatctcaggatggcatggaggtgagggttttcccatctctg |
26706505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University