View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1728_high_8 (Length: 226)
Name: NF1728_high_8
Description: NF1728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1728_high_8 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 32811961 - 32812179
Alignment:
| Q |
5 |
taaattccctggttgaaacgaaaatatattcaataatgtattaattgattcaaattaacattagttatacactagaaactaatgttattactgatttgct |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32811961 |
taaaatccctggttgaaacgaaaatatatt---taatgtattaattgattcaaattaactttagttatatactagaaactaatgttattactgatttgct |
32812057 |
T |
 |
| Q |
105 |
ttgataggtaacatccttcaagtgtggtggtttcgcatttggcatcacaagaagccatgcagccattgatgggcatagcctcaaaatattcttagacaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32812058 |
ttgataggtaacatccttcaagtgtggtggtttcgcatttggcatcacaagaagccatgcagccattgatgggcatagcctcaaaatattcttagacaac |
32812157 |
T |
 |
| Q |
205 |
cttgctgcattggctgctaaca |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32812158 |
cttgctgcattggctgctaaca |
32812179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 113 - 219
Target Start/End: Original strand, 32829599 - 32829705
Alignment:
| Q |
113 |
taacatccttcaagtgtggtggtttcgcatttggcatcacaagaagccatgcagccattgatgggcatagcctcaaaatattcttagacaaccttgctgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| |||||| |||||||| | || ||||||| | |||| |||||| |||||||||||||||||| | |
|
|
| T |
32829599 |
taacatccttcaagtgtggtggtttcgctataggcttcacaacaagccatgtaacctttgatggacttagcttcaaaaatttcttagacaaccttgcttc |
32829698 |
T |
 |
| Q |
213 |
attggct |
219 |
Q |
| |
|
||||||| |
|
|
| T |
32829699 |
attggct |
32829705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University