View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1728_low_2 (Length: 388)
Name: NF1728_low_2
Description: NF1728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1728_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 245 - 388
Target Start/End: Complemental strand, 35112611 - 35112468
Alignment:
| Q |
245 |
gcgcaaaacaaaataagccaacggattccagacgtgtttggaagggaatgaattatcacctcatccgttgccgaaaacgactctgataccaaacattgcc |
344 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
35112611 |
gcgcaaaacaaaataagccaactaattccagacgtgtttggaagggaatgaattatcacctcatccgttgccgaaaacgacaccgataccaaacattgcc |
35112512 |
T |
 |
| Q |
345 |
gtgtcaaattgatccatagcccaaaaatatcagtccacgtgtga |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35112511 |
gtgtcaaattgatccatagcccaaaaatatcagtccacgtgtga |
35112468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 270 - 386
Target Start/End: Original strand, 47987982 - 47988098
Alignment:
| Q |
270 |
ttccagacgtgtttggaagggaatgaattatcacctcatccgttgccgaaaacgactctgataccaaacattgccgtgtcaaattgatccatagcccaaa |
369 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||| ||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47987982 |
ttccagacgtgtttggaagggaatgcattgtcacctcatctgttgctgtaaacgactcagataccaaacattgccgtgtcaaattgatccatagcccaaa |
47988081 |
T |
 |
| Q |
370 |
aatatcagtccacgtgt |
386 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47988082 |
aatatcagtccacgtgt |
47988098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University