View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729-Insertion-2 (Length: 160)
Name: NF1729-Insertion-2
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729-Insertion-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 2e-59; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 38085272 - 38085157
Alignment:
| Q |
8 |
atacaaggatgacccaactatttttgcttgggagcttatgaatgagccccgttacgtaaatgactctggaaaatcaattcaggtccttttaatttccttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38085272 |
atacaaggatgacccaactatttttgcttgggagcttatgaatgagccccgttacgtaaatgactctggaaaatcaattcaggtccttttaatttccttc |
38085173 |
T |
|
| Q |
108 |
ctttttgtttgctaca |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38085172 |
ctttttgtttgctaca |
38085157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 38155303 - 38155211
Alignment:
| Q |
8 |
atacaaggatgacccaactatttttgcttgggagcttatgaatgagccccgttacgta---aatgactctggaaaatcaattcaggtcctttt |
97 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||||||| || |||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
38155303 |
atacaaagatgatccaactatttttgcatgggagcttatgaatgaacctcgttgcataaataatgactctggaaaatcaattcaggtcctttt |
38155211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 12 - 97
Target Start/End: Complemental strand, 38142146 - 38142058
Alignment:
| Q |
12 |
aaggatgacccaactatttttgcttgggagcttatgaatgagccccgttacgta---aatgactctggaaaatcaattcaggtcctttt |
97 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| || |||| | || |||||||| ||||||||||||||||||||||| |
|
|
| T |
38142146 |
aaggatgacccaaccatttttgcatgggagcttatgaatgaacctcgttgcatatttaatgactccggaaaatcaattcaggtcctttt |
38142058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 12 - 92
Target Start/End: Complemental strand, 38110558 - 38110478
Alignment:
| Q |
12 |
aaggatgacccaactatttttgcttgggagcttatgaatgagccccgttacgtaaatgactctggaaaatcaattcaggtc |
92 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||| || || || ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
38110558 |
aaggatgatccaaccattttcgcttgggagcttataaacgaaccacgttatgtaaatgactctggaaattcaattcaggtc |
38110478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 38090204 - 38090124
Alignment:
| Q |
8 |
atacaaggatgacccaactatttttgcttgggagcttatgaatgagccccgttacgtaaatgactctggaaaatcaattcaggt |
91 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||| || || |||| |||||| ||||||||| |||||||| |
|
|
| T |
38090204 |
atacaaggatgacccaacaatttttgcttgggagctaatgaatgaacctcg---cgtacatgactttggaaaatcgattcaggt |
38090124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000008; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 281696 - 281739
Alignment:
| Q |
12 |
aaggatgacccaactatttttgcttgggagcttatgaatgagcc |
55 |
Q |
| |
|
||||| || ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
281696 |
aaggaagatccaacaatttttgcttgggagctaatgaatgagcc |
281739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 12 - 55
Target Start/End: Complemental strand, 634156 - 634113
Alignment:
| Q |
12 |
aaggatgacccaactatttttgcttgggagcttatgaatgagcc |
55 |
Q |
| |
|
||||| || ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
634156 |
aaggaagatccaacaatttttgcttgggagctaatgaatgagcc |
634113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 12 - 55
Target Start/End: Complemental strand, 819959 - 819916
Alignment:
| Q |
12 |
aaggatgacccaactatttttgcttgggagcttatgaatgagcc |
55 |
Q |
| |
|
||||| || ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
819959 |
aaggaagatccaacaatttttgcttgggagctaatgaatgagcc |
819916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University