View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729-Insertion-7 (Length: 257)
Name: NF1729-Insertion-7
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729-Insertion-7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 2382355 - 2382117
Alignment:
| Q |
8 |
cgtagtggatcaaaatatgttacaattaacgtgcaaaactcagcacatgctattgtttgaagaatttgcaaacatcaaaaccaaacatgtactatgtaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382355 |
cgtagtggatcaaaatatgttacaattaacgtgcaaaactcagcacatgctatt-----------ttgcaaacatcaaaaccaaacatgtactatgtaac |
2382267 |
T |
|
| Q |
108 |
caaaaatacagaaaaaggaccaaacatgttttgaattattaccagttttacgaattccaaaacgtgtggcaatggaaatccaaaacctacgaacaggatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382266 |
caaaaatacagaaaaaggaccaaacatgttttgaattattaccagttttacgaattccaaaacgtgtggcaatggaaatccaaaacctacgaacaggatg |
2382167 |
T |
|
| Q |
208 |
catgatgttctgccacaactccacctgccgagagaatttcatcttctcca |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382166 |
catgatgttctgccacaactccacctgccgagagaatttcatcttctcca |
2382117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University