View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17290_high_13 (Length: 230)
Name: NF17290_high_13
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17290_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 10214322 - 10214232
Alignment:
| Q |
18 |
tctcttacatttcagaataattcgttgctgtattcgacctgaataccttcaatttctaccgcattcgctccaccacctttcttggttagtt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10214322 |
tctcttacatttcagaataattcgttgctgtattcgacctgaataccttcaatttctaccgcattcgctccaccacctttcttggttagtt |
10214232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 10214168 - 10214125
Alignment:
| Q |
172 |
ttaaattagcgattaaggttgatggatgcttttgttaatttcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10214168 |
ttaaattagcgattaaggttgatggatgcttttgttaatttcat |
10214125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University