View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17290_high_15 (Length: 225)
Name: NF17290_high_15
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17290_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 18564246 - 18564052
Alignment:
| Q |
15 |
aaccgccactgaggaaagaattcttctccacaccataattttcgaaaggaggattattcttggaacaccagcataggagctgtcgcaatgaaccattcac |
114 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18564246 |
aaccgccactgaggaaagaattcttcttcgcaccataattttcgaaaggaggattattctcggaacaccagcataggagctgtcgcaatggaccattcac |
18564147 |
T |
|
| Q |
115 |
cagaaaggttgcataataccttatccctcgcgttttcacaaagccgtcgaagctggagacctatgacggcaccaccgatctggacgagcacatag |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
18564146 |
cagaaaggttgcataataccctatccctcacgttttcgcaaagccgtcgaagctggagatctatgacggcaccattaatccggacgagcacatag |
18564052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University