View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17290_high_9 (Length: 257)

Name: NF17290_high_9
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17290_high_9
NF17290_high_9
[»] chr2 (1 HSPs)
chr2 (21-239)||(45556881-45557099)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 239
Target Start/End: Complemental strand, 45557099 - 45556881
Alignment:
21 acacgcttacactacttttgaacacagtcctgccgattcaacccttttaggggaaaatatagggtcgggtgcagaagttaggctcagactgcggaggcct 120  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45557099 acacgcttacactacttttgaacacagtcctgccgatccaacccttttaggggaaaatatagggtcgggtgcagaagttaggctcagactgcggaggcct 45557000  T
121 gatcgggactgggatttcttcccatatgaagagattctcgataccatgttacatgagctttgccataatgaatacggttctcacaatactcacttttata 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
45556999 gatcgggactgggatttcttcccatatgaagagattctcgataccatgttacatgagctttgccataatgaatacggtcctcacaatactcacttttata 45556900  T
221 acctttgggatgaaatcag 239  Q
    |||||||||||||||||||    
45556899 acctttgggatgaaatcag 45556881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University