View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17290_low_12 (Length: 257)
Name: NF17290_low_12
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17290_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 239
Target Start/End: Complemental strand, 45557099 - 45556881
Alignment:
| Q |
21 |
acacgcttacactacttttgaacacagtcctgccgattcaacccttttaggggaaaatatagggtcgggtgcagaagttaggctcagactgcggaggcct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45557099 |
acacgcttacactacttttgaacacagtcctgccgatccaacccttttaggggaaaatatagggtcgggtgcagaagttaggctcagactgcggaggcct |
45557000 |
T |
 |
| Q |
121 |
gatcgggactgggatttcttcccatatgaagagattctcgataccatgttacatgagctttgccataatgaatacggttctcacaatactcacttttata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45556999 |
gatcgggactgggatttcttcccatatgaagagattctcgataccatgttacatgagctttgccataatgaatacggtcctcacaatactcacttttata |
45556900 |
T |
 |
| Q |
221 |
acctttgggatgaaatcag |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45556899 |
acctttgggatgaaatcag |
45556881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University