View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17290_low_15 (Length: 246)
Name: NF17290_low_15
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17290_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 40944370 - 40944283
Alignment:
| Q |
151 |
tacaagtaaattttcataaaaatcatctttacaaatataaaacatgatctaaaaatttattatcttcataacacagcacagtattatc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
40944370 |
tacaagtaaattttcataaaaatcatctttacaaatataaaacatgatctaaaaatttattatcttcataacacaccacactattatc |
40944283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University