View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17290_low_20 (Length: 218)
Name: NF17290_low_20
Description: NF17290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17290_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 44316287 - 44316101
Alignment:
| Q |
13 |
attattctccagccagcaagatctatgaagaagtgattacggacatcaacatagactaaattgacgcaattgcattgtacaaggacagtcactcagcatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44316287 |
attattctccagccagcaagatctatgaagaagtgattacggacatcaacatagactaaattgacgcaattgcattgtacaaggacagtcactcagcatg |
44316188 |
T |
 |
| Q |
113 |
tggaaggtatgtgctgcaaattatgaagttgttgtttaaatgtcaaacaccaattttcaaattagtgactatgatttgttactcttt |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44316187 |
tggaaggtatgtgatgcaaattatgaagttgttgtttaaatgtcaaacaccaattttcaaattagtgactatgatttgttactcttt |
44316101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University