View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17291_low_4 (Length: 264)
Name: NF17291_low_4
Description: NF17291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17291_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 25492975 - 25493228
Alignment:
| Q |
1 |
ctccctgtacttacaatacaacaaaaatgagatttagtaacatttgaaaaatattattgttactaaaggtcctaaatgttgtagtattatgaattgaaaa |
100 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25492975 |
ctccatgtacttacactacaataaaaatgagatttagtaacatttgaaaaatattattgttactaaaggtcctaaatgttgtagcattatgaattgaaaa |
25493074 |
T |
 |
| Q |
101 |
ttgcattgcatatttgctaactt--gctcatctgcattttcatatggatctaaaattcttttattttattttatttcagggcatgcacttcctatatgta |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
25493075 |
ttgcattgcatatttgctaacttgcgctcatctgcattttcatatgcatctaa-----ttttatttt-ttttatttcaggagatgcacttcctatatgta |
25493168 |
T |
 |
| Q |
199 |
gatat-gctattgatctttgttttggcagctacggccactagcttattctataaggactt |
257 |
Q |
| |
|
||||| | || ||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25493169 |
gatatggttactgatctttgctttggcagctacgaccactagcttattctataaggactt |
25493228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 26173784 - 26173823
Alignment:
| Q |
17 |
tacaacaaaaatgagatttagtaacatttgaaaaatatta |
56 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
26173784 |
tacaacaaaaatgagatttagtaacacttaaaaaatatta |
26173823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 52
Target Start/End: Complemental strand, 9438823 - 9438791
Alignment:
| Q |
20 |
aacaaaaatgagatttagtaacatttgaaaaat |
52 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
9438823 |
aacaaaaatgagatttagtaacacttgaaaaat |
9438791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University