View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17291_low_5 (Length: 238)
Name: NF17291_low_5
Description: NF17291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17291_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 80 - 226
Target Start/End: Original strand, 34837497 - 34837643
Alignment:
| Q |
80 |
aaaatgtgaaatcggtctctaatattagccactagtgggttgcctacttttcctaaataagtcttaaatcgatcacaatatgtatatataatattaaaaa |
179 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34837497 |
aaaatgtgagatcggtctctaatattagccactagtgggttgcctacttttcctaaataagtcttaaatcgatcacaatatgtatatataatattaaaaa |
34837596 |
T |
|
| Q |
180 |
attcacaacactatacatcaaaccttctatgtgttagtctctctctc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34837597 |
attcacaacactatacatcaaaccttctatgtgttagtctctctctc |
34837643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 5 - 58
Target Start/End: Original strand, 34837446 - 34837499
Alignment:
| Q |
5 |
tatttcaaagaatataaaatagtattttatttaatttgcattgtgcttttaaaa |
58 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34837446 |
tatttcaaagaatataaaatagcattttatttaatttgcattgtgcttttaaaa |
34837499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University