View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17293_high_14 (Length: 233)

Name: NF17293_high_14
Description: NF17293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17293_high_14
NF17293_high_14
[»] chr3 (1 HSPs)
chr3 (14-208)||(7184781-7184975)


Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 7184975 - 7184781
Alignment:
14 cagaacctgtgttgatcagtgtgtataatgaacttacaaattagtaagtaggttcaccatttcttcacttccaaggtgatggcgaacaagtctctaacaa 113  Q
    ||||| |||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
7184975 cagaaactgtgttgatcagtttgtataatgaacttacgaattagtaagcaggttcaccatttcttcacttccaaggtgatggcgaacaagtctctaacaa 7184876  T
114 aacatggcgcaacacctctttgatgttaggcaaaacctgactaggggccacaatcttggccttattgaagtaatcaaactctgcttggggggttt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
7184875 aacatggcgcaacacctctttgatgttaggcaaaacctgactaggggccacaatcttggccttattgaagtaatcaaactctgcttgggaggttt 7184781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University