View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17293_high_16 (Length: 202)
Name: NF17293_high_16
Description: NF17293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17293_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 3006664 - 3006830
Alignment:
| Q |
20 |
ggaaaagagcagagttgcttcacaaggctgcagcaatattgaaggaacacaaagcacctattgctgagtgtcttgttaaagagattgcaaaaccagccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3006664 |
ggaaaagagcagagttgcttcacaaggctgcagcaatattgaaggaacacaaagcacctattgctgagtgtcttgttaaagagattgcaaaaccagccaa |
3006763 |
T |
|
| Q |
120 |
ggatgctgtcactgaagtatgtataaacagttgaacttttcatttatttaatggttgtaaagttctt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3006764 |
ggatgctgtcactgaagtatgtataaacagttgaacttttcatttatttaatggttgtaaagttctt |
3006830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University