View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17293_low_15 (Length: 230)

Name: NF17293_low_15
Description: NF17293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17293_low_15
NF17293_low_15
[»] chr5 (1 HSPs)
chr5 (1-195)||(18877852-18878043)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 18878043 - 18877852
Alignment:
1 gtggttttagccctggtcctatgactcttctctctaacttatttgctgatggtggtgatgacgacaagtctttctctcagcttctcgccggtgccatggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||   |||||| |||||||||||||||||||||||||||| |||||||    
18878043 gtggttttagccctggtcctatgactcttctctctaacttatttgctgatagtg---atgacggcaagtctttctctcagcttctcgccggttccatggt 18877947  T
101 gtctccggcaccggtaaccaccggggggcttgattcatctggcttctttccacatcctcaggtgaaaattcttttttatgtatatagcttatgct 195  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
18877946 gtctccggcaccgctaaccgccggggggcttgattcatctggcttcttttcacatcctcaggtgaaaattcttttttatgtatatagcttatgct 18877852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University