View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17295_high_3 (Length: 287)
Name: NF17295_high_3
Description: NF17295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17295_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 66 - 271
Target Start/End: Complemental strand, 53033464 - 53033258
Alignment:
| Q |
66 |
ttatcttgggaaagttactagcaagtgccaaa-gtgtcttgcatatatttttcttttgaaggaaacaacgatgatagttaaacaccttaacttcttaatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033464 |
ttatcttgggaaagttactagcaagtgccaaaagtgtcttgcatatatttttcttttgaaggaaacaacgatgatagttaaacaccttaacttcttaatt |
53033365 |
T |
 |
| Q |
165 |
aattacaattattattatagaggtaaaggagaataaattgaattgaatgaggtgataatgatgtgtgcatatataaaagttggacaaacctggtaaggca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033364 |
aattacaattattattatagaggtaaaggagaataaattgaattgaatgaggtgataatgatgtgtgcatatataaaagttggacaaacctggtaaggca |
53033265 |
T |
 |
| Q |
265 |
ataaatg |
271 |
Q |
| |
|
||||||| |
|
|
| T |
53033264 |
ataaatg |
53033258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University