View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17298_high_7 (Length: 226)
Name: NF17298_high_7
Description: NF17298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17298_high_7 |
 | |
|
| [»] scaffold0194 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0194 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 55 - 226
Target Start/End: Complemental strand, 26454 - 26283
Alignment:
| Q |
55 |
tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454 |
tattacaacttctttcctagtttgtgtctaactctaaccattgtttaaaactttggtgcaatatagtgagctagaacatacaatttttcttgaagaaaat |
26355 |
T |
|
| Q |
155 |
aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26354 |
aaataaattaaaattaccctttgcacgtatgaaccaggcatgagggatctaagaacacgaagatgttcattc |
26283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University