View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17298_low_5 (Length: 240)
Name: NF17298_low_5
Description: NF17298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17298_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 29335416 - 29335629
Alignment:
| Q |
17 |
aagttcattgctgctctcgctggtgcttgagaatgagattcctgttgaatctcgagcaaccaagtcattgttgttgaaattgagtgttaagtccagtgag |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29335416 |
aagttcattgctgctctcactggtgcttgagaatgagattcctgttgaatctcgaacaaccaagtcattgttgttgaaattgagtgttaagtccagtgag |
29335515 |
T |
 |
| Q |
117 |
atggaatctgaattggaaaggctgttactataggaacctggagaggtttcaatttggtgggtggatatagtggaagcaacatggctactaacatcagatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29335516 |
atggaatctgaattggaaaggctgttactataggaacctgtagaggtttcaatttggtgggtggatatagtggaagcaacatggctactaacatcagatt |
29335615 |
T |
 |
| Q |
217 |
catattcttctgtg |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29335616 |
catattcttctgtg |
29335629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University