View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_high_18 (Length: 332)
Name: NF1729_high_18
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 101 - 327
Target Start/End: Complemental strand, 26216518 - 26216292
Alignment:
| Q |
101 |
agtagttgtcaagcattctagatgtgcattaggaaatgtatgacacaaatcaccatcggtgcgtgctctatcaagttttacctccactgtgtgctctgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26216518 |
agtagttgtcaagcattctagatgtgcattaggaaatgtttgacacaaatcaccattggtgcgtgctctatccagttttacctccactgtgtgctctgtg |
26216419 |
T |
 |
| Q |
201 |
ccaataaaatggaaccaagtaaattaatagccttccttgcgcaaatcgaacaacctggaatctgatactgcttgtctaaacctattgatcactcgacttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216418 |
ccaataaaatggaaccaagtaaattaatagccttccatgcgcaaatcgaacagcctggaatttgatactgcttgtctaaacctattgatcactcgacttg |
26216319 |
T |
 |
| Q |
301 |
gacagtcaacacatcttttcttctctc |
327 |
Q |
| |
|
|||| | ||||||||||||||| |||| |
|
|
| T |
26216318 |
gacaattaacacatcttttcttttctc |
26216292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 13 - 99
Target Start/End: Complemental strand, 26216637 - 26216551
Alignment:
| Q |
13 |
tcaaaatcctcaaagcctggttcttccaacaaagcattttcaaacttgaaccgccgcattgaactcatagaagtcctgatcggatca |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
26216637 |
tcaaaatcctcaaagcctggttctgccaacaaagcattttcaaacttgaaccgccgcgttgaactcatagaagtactgatgggatca |
26216551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University