View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_high_21 (Length: 298)
Name: NF1729_high_21
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 157 - 284
Target Start/End: Complemental strand, 8393231 - 8393103
Alignment:
| Q |
157 |
agatatgaacctcatacctttgactatatattatgcattgtacatatcagttaaattaaactcacaaaaaca-cccattttatttttcatacagatattc |
255 |
Q |
| |
|
|||| |||| ||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||| | ||| ||| ||||||||||||||| |||||| |
|
|
| T |
8393231 |
agatttgaatctcatacctttaactatatattatgcattgtacataccagctaaattaaactcacatagacacccccttttatttttcataccaatattc |
8393132 |
T |
 |
| Q |
256 |
aacatctcattttccttttaccactcttt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8393131 |
aacatctcattttccttttaccactcttt |
8393103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 12 - 96
Target Start/End: Complemental strand, 8393370 - 8393286
Alignment:
| Q |
12 |
agagatggggtggtatggtatggtatgggatatgggcatcattgggtttgttatttcctcttgttttctagtaatttcggtgttc |
96 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
8393370 |
agagagggtgtggtatggtatggtatgggaaatgggaatcattgggtttgttattttctcttgttttctagtaattttggtgttc |
8393286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University