View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_high_23 (Length: 292)
Name: NF1729_high_23
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 278
Target Start/End: Original strand, 43205198 - 43205464
Alignment:
| Q |
12 |
ataattcttggattgtgatttcaacatgtggcgcgttatcaacttcgacaacaggtttaatgattcctctatgaagtaggtgtggcttctctggtgagac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43205198 |
ataaatcttggattgtgatttcaacatgtgacgcgttatcaacttcgacaacaggtttaatgattcctctatgaagtaggtgtggcttctctggtgagac |
43205297 |
T |
|
| Q |
112 |
attagattctacactcttgaaatgtgctaaattcgaaagctcagaaacagattcatagattttctccactgagatagtgatttcttcaagtattgcagca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43205298 |
attagattctacactcttgaaatgtgctaaattcgaaagctcagaaacagattcatagattttctccactgagatagtgatttcttcaagtattgcagca |
43205397 |
T |
|
| Q |
212 |
actgtggcaactgggattatagctaggagttccacatcctctaaggaaatggcttctagtgcaactt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43205398 |
actgtggcaactgggattatagctaggagttccacatcctctaaggaaatggcttctagtgcaactt |
43205464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University