View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_high_42 (Length: 230)
Name: NF1729_high_42
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_high_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 33352980 - 33352884
Alignment:
| Q |
20 |
atctacctttaattatttcattttcttaaattattttcaaggttgatgtgtctctgtcgtgttaggcctccatatctacgtgaatgctagttcgtag |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33352980 |
atctacctttaattatttcattttcctaaattatttttaaggttgatgtgtccctgtcgtgttaggcctccatatctacgtgaatgctaattcgtag |
33352884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 37436305 - 37436273
Alignment:
| Q |
27 |
tttaattatttcattttcttaaattattttcaa |
59 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
37436305 |
tttaattatttcattttcttaaattattatcaa |
37436273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University