View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_high_44 (Length: 227)
Name: NF1729_high_44
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_high_44 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 34330448 - 34330668
Alignment:
| Q |
7 |
gttgttgctgctgattgtaactttttggatgttgtcgttgttggttccttcgttgaagtatttgtgtgcgtcgaatatgctgagttctgaggtgggatcg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330448 |
gttgttgctgctgattgtaactttttggatgttgtcgttgttggttccttcgttgaagtatttgtgtgcgtcgaatatgctgagttctgaggtgggatcg |
34330547 |
T |
|
| Q |
107 |
tcgagtttgtggtggtgattatgattatttggcttttggggtgtgagataggatgagaaagatgcatctatatctcttaagatggttggtgattttggag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330548 |
tcgagtttgtggtggtgattatgattatttggcttttggggtgtgagataggatgagaaagatgcatctatatctcttaagatggttggtgattttggag |
34330647 |
T |
|
| Q |
207 |
gcaggttacaatcaaaggttt |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34330648 |
gcaggttacaatcaaaggttt |
34330668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University