View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_high_48 (Length: 220)
Name: NF1729_high_48
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_high_48 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 44088667 - 44088880
Alignment:
| Q |
1 |
tcatcaatgttcaatagtttcagaaccttcaagaagcaaagatattttagaaggaaagaaagaacttatggaaatgattcaagacatgcccgagtctagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44088667 |
tcatcaatgttcaatagtttcagaaccttcaagaagcaaagatattttagaaggaaagaaagaacttatggaaatgattcaagacatgcccgagtctagc |
44088766 |
T |
|
| Q |
101 |
tatgaactctcttttcaagacatggttgttgagcagcatcaagttccacaaccagaaacagaaacagaaccagtgtatagtaaatttcaacaaccacaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44088767 |
tatgaactctcttttcaagacatggttgttgagcagcatcaagtt------ccagaaacagaaacagaaccagtgtatagtaaatttcaacaacctcaac |
44088860 |
T |
|
| Q |
201 |
agaaaaagctgaataagaat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44088861 |
agaaaaagctgaataagaat |
44088880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University