View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_13 (Length: 397)
Name: NF1729_low_13
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 6 - 379
Target Start/End: Original strand, 48271221 - 48271594
Alignment:
| Q |
6 |
aggagcagagatgtgctagtaaagagaattggtcagcaactagaggaggcttcggtaaacgatattttgattaaagcaccagatggagagattacaatgt |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271221 |
aggatcagagatgtgctagtaaagagaattggtcagcaactagaggaggcttcggtaaacgatattttgattaaagcaccagatggagagattacaatgt |
48271320 |
T |
 |
| Q |
106 |
atgatgttggtatagtacagaaaattgtaagggagtttcttatgaaagatcacaattccgagattgaattggttggaggtggcgaacttgaagggataag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271321 |
atgatgttggtatagtacagaaaattgtaagggagtttcttatgaaagatcacaattccgagattgaattggttggaggtggcgaacttgaagggataag |
48271420 |
T |
 |
| Q |
206 |
aaagccggggattttatcagatgcctctaagctgatggttgccaaactcatagatggataccttgctgaaattgcgaaggatcctaatttaccattgttg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271421 |
aaagccggggattttatcagatgcctctaagctgatggttgcaaaactcatagatggataccttgctgaaattgcgaaggatcctaatttaccattgttg |
48271520 |
T |
 |
| Q |
306 |
aattttgttaatcttgctgagttagtttctaggatctctcgtccgtctcatgatggcctttacagggctattga |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271521 |
aattttgttaatcttgctgagttagtttctaggatctctcgtccgtctcatgatggcctttacagggctattga |
48271594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University