View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_14 (Length: 392)
Name: NF1729_low_14
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 10 - 383
Target Start/End: Complemental strand, 42223649 - 42223276
Alignment:
| Q |
10 |
aaaatagaggtggacctgtcgcaggttgtggttgctaatggtaaccaacggtccaagtaaaattattgatcatgatggattaatgtggaaggccgacaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42223649 |
aaaatagaggtggacctgtcgcaggttgtggttgctaatggtaacaaacagtccaagtaaaattattgatcatgatggattaatgtggaaggccgacaga |
42223550 |
T |
|
| Q |
110 |
ctcgtctaacctcccatttcatcattgctactataaaattatgggaaatgctaatttatccttatcatctttcgttttccatccaaccttgttgggatgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
42223549 |
ctcgtctaacctcccatttcatcattgctactataaaattatgggaaatgctaatttatccttatcatttttcgttttccatccaatcttgttgggatgt |
42223450 |
T |
|
| Q |
210 |
tttgtttttaaagatgcaattttatcattgcctaaagcaatgcctgaagtttattaagcagcacacttctcttacagagttgcacttgcatcttttgggc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42223449 |
tttgtttttaaagatgcaattttatcattgcctaaagcaatgcctgaagtttattaagcagcacacttctcttacagagttgcacttgcatcttttgggc |
42223350 |
T |
|
| Q |
310 |
tgaaatgtaatcagatcgcatccacccaccagaattttaatttataaatatcttcttagtcaatttcatctcac |
383 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42223349 |
tgaaatgtaatcagatcacatccacccaccagaattttaatttataaatatcttcttagtcaatttcatttcac |
42223276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University