View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_30 (Length: 250)
Name: NF1729_low_30
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 8393340 - 8393571
Alignment:
| Q |
1 |
ttcccataccataccataccacaccatctcttttcttctccacactcaataaacaaaacttaatttattcacaacctaacatataacaataacaataaca |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8393340 |
ttcccataccataccataccacaccctctcttttcttctccacactcaataaacaaaacttaatttattcacaacctaaaatataacaataacaat---- |
8393435 |
T |
 |
| Q |
101 |
atccaaaaacctcattgattcattcattcagcaatatatcaa-gaaaacaaactggagatgttagatgcaatactgatggcactattcctgccttgcata |
199 |
Q |
| |
|
|||||||||| ||| ||| ||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393436 |
--ccaaaaacctgattcattgattgattctgcaatatatcaaagaaaacaaactggagatgttagatgcaatactgatggcactattcctgccttgcata |
8393533 |
T |
 |
| Q |
200 |
ggcatgggtgtgatcttattagtttacatgtgtcttct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393534 |
ggcatgggtgtgatcttattagtttacatgtgtcttct |
8393571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University