View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_31 (Length: 250)
Name: NF1729_low_31
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 3 - 177
Target Start/End: Complemental strand, 43460982 - 43460819
Alignment:
| Q |
3 |
gagtttgattctttgagtggaacaattattgagaaccggagggtaaaaataaaaatatgtgagtgtgttttcttgctagctgttaatgcgatttcattgt |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
43460982 |
gagtttgattacttgagtggaacaattattgagaaccggagggtaaaaataaaaatatgt--gtgtgttttcttgctagctgttaatg---------tgt |
43460894 |
T |
|
| Q |
103 |
tttcatttgcaatttactctcaaaatgtcgccgtcattgtttacggtggaagaataacgtgagagattagtatca |
177 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43460893 |
tttcatttgcaatttactctcaatatgtcgccatcattgtttacggtggaagaataacgcgagagattagtatca |
43460819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 240
Target Start/End: Complemental strand, 43460815 - 43460776
Alignment:
| Q |
201 |
gaagaattttggcatctagtttcaaaaacgttatcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43460815 |
gaagaattttggcatctagtttcaaaaacgttatcctatg |
43460776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University