View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_32 (Length: 249)
Name: NF1729_low_32
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_32 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 7721692 - 7721933
Alignment:
| Q |
8 |
gagcacagatggatttagcattggaaatgtgttccttgatttctgtggaggaatggcaaattatgctcagatggttatacaatcaattgatcaaagtatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721692 |
gagcacagatggatttagcattggaaatgtgttccttgatttctgtggaggaatggcaaattatgctcagatggttatacaatcaattgatcaaagtatg |
7721791 |
T |
 |
| Q |
108 |
tctttatttccaaattcacattatagtaacattccaaatgacttgatgcatcaatgcatgtaat-taataacatttcttctcnnnnnnncattctagact |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
7721792 |
tctttatttccaaattcacattatattaacattccacatgacttaatgcatcaatgcatgtaatataataacatttcttctc-ttttttcattctagact |
7721890 |
T |
 |
| Q |
207 |
cttgggtgaatttctctgggaaccttggaaaagtattgttatc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721891 |
cttgggtgaatttctctgggaaccttggaaaagtattgttatc |
7721933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 7738106 - 7738147
Alignment:
| Q |
8 |
gagcacagatggatttagcattggaaatgtgttccttgattt |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
7738106 |
gagcacagatggatttagcattggcaatgttctccttgattt |
7738147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University