View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_40 (Length: 236)
Name: NF1729_low_40
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 38554481 - 38554288
Alignment:
| Q |
13 |
aatatatagagaatagctaatgcataaatacagaataaaaagttttttaaatgctttgataaacaatttctctgaaggtaattgctagagttgacttcaa |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38554481 |
aatatatagagaataggtaatgcataaatacagaataaaaagttttttaaatgctttga----------------aggtaattgctagagttgacttcaa |
38554398 |
T |
 |
| Q |
113 |
acattatttcattatttgattgaattggttgcctgcttgatgtgtaaggaagatgatcacttcagtttggattctcttttattggaccccaatacttgtg |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38554397 |
acattatttcattatttgattgaatcggttgcctgcttgatgtgtaaggaagatgatcacttgagtttggattctcttttattggaccccaatacttgtg |
38554298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University