View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_41 (Length: 235)
Name: NF1729_low_41
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 11284919 - 11285138
Alignment:
| Q |
2 |
atgtcaaggtggatagagtgagttagaattaagggagagtgaataacaaattgacttaaactaaatcacatcaagtggataattcaaatgccagatgaca |
101 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||| ||||||| |||||||||| ||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
11284919 |
atgtcaaggtagatagaatgagttagaattaagtgagtatgaataataaattgacttcaactaaaaaacatcaagtggataattcaaatgccaaatgaca |
11285018 |
T |
|
| Q |
102 |
attgaatcgtggcacagcatgttagggccctacctgcaaagtctctgactaaaagttctcaaaacagctggttggcgcccgccaccatactgaatttctc |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11285019 |
attgaatcgtggca--gcatgttagggccctacctgcaaagtctctgactaaaagttctcaaaacagctggttggcgcccgccaccatactgaatttctc |
11285116 |
T |
|
| Q |
202 |
cactggattcttgtgctatctg |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11285117 |
cactggattcttgtgctatctg |
11285138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University