View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_42 (Length: 235)
Name: NF1729_low_42
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 3366819 - 3366611
Alignment:
| Q |
11 |
caaaggaaacaaattgacaagataaagcaactgaaacagaataaaatcaaggagaaacgaaacttcagctacagaaaagcgtgaacaaaaggagaacgaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
3366819 |
caaaggaaacaaattgacaagataaagcaactgaaacagaataaaatcaaggagaaacgaaacttcagctacagagaagcgtgaacaaaagaagaacgaa |
3366720 |
T |
|
| Q |
111 |
acaaagtgatgaaggacacatctgaatacaaggaaaagagacccgttgctacaagtaaatgtgcaattggaaataaacattataaaaacataggaatact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3366719 |
acaaagtgatgaaggacacatctgaatacaaggaaaagagacccgttgctacaagtgaatgtgcaattggaaataaacattataaaaacataggaatact |
3366620 |
T |
|
| Q |
211 |
atttttatg |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
3366619 |
atttttatg |
3366611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University