View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1729_low_45 (Length: 232)

Name: NF1729_low_45
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1729_low_45
NF1729_low_45
[»] chr4 (1 HSPs)
chr4 (13-232)||(44725201-44725420)


Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 232
Target Start/End: Original strand, 44725201 - 44725420
Alignment:
13 aatattggcattactcgaaaataaccctagtttgagccaattagtcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaaga 112  Q
    ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44725201 aatattggcattacttgaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaaga 44725300  T
113 gaacgagaggctaatggatctctaatgcactgaaggaaagattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaag 212  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44725301 gaacgagaggctaatggatctctaatgcactgaaggaaatattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaag 44725400  T
213 caaaggaatcattgttacaa 232  Q
    |||||| |||||||||||||    
44725401 caaagggatcattgttacaa 44725420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University