View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_51 (Length: 226)
Name: NF1729_low_51
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 47089907 - 47090125
Alignment:
| Q |
1 |
ctttacaagcttgtagagcatatcggtggtaaagaaaggttgttgcaagaccttctgaatgaagggcaagcgaatgagggcaccagttctcttgtcatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47089907 |
ctttacaagcttgtagagcatatcggtggtaaagaaaggttgttgcaagaccttctgaatgaagggcaagcgaatgagggcaccagttctcttgtcatac |
47090006 |
T |
|
| Q |
101 |
tttttcagtattttcactagccctgtggaaggaaaagtgaggtgatagttagatacacgcgatgtagttgattnnnnnnnntgaaaacaccatagggcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| || |
|
|
| T |
47090007 |
tttttcagtattttcactagccctgtggaaggaaaagtgaggtgatagttagatacactcgatgtagttgatt-aaaaaaatgaaaacaccatagggaat |
47090105 |
T |
|
| Q |
201 |
tcttcatttgatgttcaaga |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47090106 |
tcttcatttgatgttcaaga |
47090125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University