View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1729_low_56 (Length: 214)
Name: NF1729_low_56
Description: NF1729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1729_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 71 - 198
Target Start/End: Original strand, 34054454 - 34054581
Alignment:
| Q |
71 |
taaacaaaatgttttcacataaaaggttgtttgcattcaaaattttcatttgtttgagaaatttgttgacactaatgattagagagcttaaataaataaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34054454 |
taaacaaaatgttttcacataaaaggttgtttgcattcaaaatgttcatttgtttgagaaatttgttgacactaatgattagagagcttaaataaataaa |
34054553 |
T |
 |
| Q |
171 |
gtggggggaattcaaaggcagccatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34054554 |
gtggggggaattcaaaggcagccatatt |
34054581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 47383883 - 47383829
Alignment:
| Q |
76 |
aaaatgttttcacataaaaggttgtttgcattcaaaattttcatttgtttgagaa |
130 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
47383883 |
aaaatgttttcacataaaagcttgtttgcattgaaaatgttcatttgtttgagaa |
47383829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University