View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17300_high_4 (Length: 299)
Name: NF17300_high_4
Description: NF17300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17300_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 280
Target Start/End: Complemental strand, 21830417 - 21830148
Alignment:
| Q |
11 |
gaagcaaaggttaacaagaactaatactgatataggcatggcgagcacatgtgctcgtcatgcagatataaatagaattattgtgagggattctggagat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830417 |
gaagcaaaggttaacaagaactaatactgatataggcatggcgagcacatgtgctcgtcatgcagatataaatagaattattgtgagggattctggagat |
21830318 |
T |
 |
| Q |
111 |
tcctctgttaggcatttaccatcggcgtcaccgatggtaacatccagctcaggacttggagcgttctttttaatcaaaaatttagatactggaaaagagt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21830317 |
tcctctgttaggcatttaccatcggcgtcaccgatggtaacatccagctcaggacttggagcgttctttttaatcaaaaatctagatactggaaaagagt |
21830218 |
T |
 |
| Q |
211 |
ttattgtaaaggaatacggtgaaaacgggacgtggaatcggttaagcgatttagaaacaggtaaacagtt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830217 |
ttattgtaaaggaatacggtgaaaacgggacgtggaatcggttaagcgatttagaaacaggtaaacagtt |
21830148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University