View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17300_high_6 (Length: 249)
Name: NF17300_high_6
Description: NF17300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17300_high_6 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 7123347 - 7123560
Alignment:
| Q |
1 |
catcagcagaaccgcgagtttttgaaaggtcgtttcttgcggcttcatggcgaccgcgtgaaacaagtgagcttggtgaatcaggaagaaaaagtgtgcc |
100 |
Q |
| |
|
||||| ||| ||||||| |||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7123347 |
catcatcagtaccgcgaatttttgcaagctcctttcttgcggcttcatggcgaccgcgtgaaacaagtgagcttggtgaatcaggaagaaaaagtgtgcc |
7123446 |
T |
|
| Q |
101 |
tacaacgaaaatcaccgcaggtaccgcacctagccccaagcttaatcgccatccctcaccattccataacttggcacagtaatagtttgccagattggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7123447 |
tacaacgaaaatcaccgcaggtaccgcacctagccccaagcttaatcgccatccctcaccattccataacttggcacagtaatagtttgccagattggct |
7123546 |
T |
|
| Q |
201 |
gcaatcataccaat |
214 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
7123547 |
gcaaacataccaat |
7123560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 163
Target Start/End: Original strand, 187201 - 187331
Alignment:
| Q |
33 |
tttcttgcggcttcatggcgaccgcgtgaaacaagtgagcttggtgaatcaggaagaaaaagtgtgcctacaacgaaaatcaccgcaggtaccgcaccta |
132 |
Q |
| |
|
|||||||| |||| || ||||| |||| |||||| ||| |||| |||||||||||| ||| || ||||| || ||||| ||| |||||||||||||||| |
|
|
| T |
187201 |
tttcttgcttcttcgtgacgaccacgtgtaacaagcgagtttggcgaatcaggaagacaaattgagcctataatgaaaaccactgcaggtaccgcaccta |
187300 |
T |
|
| Q |
133 |
gccccaagcttaatcgccatccctcaccatt |
163 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |
|
|
| T |
187301 |
gccccaaacttaatcgccatccctcaccatt |
187331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University