View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17300_low_7 (Length: 208)
Name: NF17300_low_7
Description: NF17300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17300_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 37 - 208
Target Start/End: Original strand, 19597275 - 19597446
Alignment:
| Q |
37 |
tggtgttaatggtggtggtggtggctgtgacggaaaagaataacaaggtggtcgtagtggccaatacggtaccatatcataatacagtgttcgaggtggc |
136 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19597275 |
tggtgttgatggtggtggtggtggctgtgacggaaaagagtaacaaggtggtcgtagtggccaatacggtaccatattataatacagtgttcgaggtggc |
19597374 |
T |
|
| Q |
137 |
tgtgatgaagaagatggtaccagcgacagatttgttggtagaatagaatgatatggtggtcgtggtggctgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597375 |
tgtgatgaagaagatggtaccagcgacagatttgttggtagaatagaatgatatggtggtcgtggtggctgc |
19597446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 28134203 - 28134258
Alignment:
| Q |
1 |
atcattgggtgatgcttcaacttttgtggattgtcgtggtgttaatggtggtggtg |
56 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28134203 |
atcattgggtgatgcttcagcttctgtggattgtcgtggtgctaatggtggtggtg |
28134258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 22256029 - 22255974
Alignment:
| Q |
1 |
atcattgggtgatgcttcaacttttgtggattgtcgtggtgttaatggtggtggtg |
56 |
Q |
| |
|
||||| |||||||||||| |||| |||| |||||||| ||| |||||||||||||| |
|
|
| T |
22256029 |
atcatagggtgatgcttctacttctgtgaattgtcgtagtgctaatggtggtggtg |
22255974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University